 |
Chlamydia trachomatis
Chlamydia trachomatis belongs to the family Chlamydiaceae, order Chlamydiales. It is an obligate intracellular human pathogen that is responsible for the leading cause of preventable blindness and bacterial sexually transmitted diseases (STD) worldwide.
The diversity of diseases include cervicitis, endometritis, and pelvic inflammatory disease in females; epididymitis in males; and urethritis, proctitis, reactive arthritis, conjunctivitis, and trachoma in both genders. Infants are susceptible to trachoma, neonatal conjunctivitis and pneumonitis. Included within the C. trachomatis species are the virulent lymphogranuloma venereum (LGV) strains that cause invasive diseases including suppurative lymphadenitis and hemorrhagic proctitis.
Transmission occurs by hand to eye to hand contact, autoinoculation, or close or intimate person to person contact. While STDs are globally distributed, trachoma is found in developing tropical countries of Central and South America, the Middle East, Africa and Asia. It is also found among aboriginal populations in Australia and rarely among Native American Indian populations.
A novel MLST scheme has recently been developed for C. trachomatis by Deborah Dean, Raymond Wan, Tigist Mehari (Children’s Hospital Oakland Research Institute and University of California) and colleagues William Bruno (Los Alamos National Labs), João P. Gomes (National Institutes of Health, Portugal), Stéphanie Devignot (Institut
de Médecine Tropicale du Service de Santé des Armées, Marseille,
France), Henry J.C. de Vries (University of Amsterdam, the Netherlands), Servaas A. Morré (Vrije Universiteit Medical Center, Amsterdam), Garry Myers (University of Maryland), Timothy D. Read (Emory University) and Brian G. Spratt (Imperial College, London).
This scheme is unlike the two previous schemes in that it utilizes exclusively housekeeping genes and was developed using clinical isolates in addition to all 19 reference strains. It has the advantage of differentiating strains phylogenetically by disease groups (trachoma, non-invasive STDs and invasive LGV STDs), can identify putative recombinant strains and single nucleotide polymorphisms (SNP) that distinguish disease groups as well as the most prevalent strains occurring worldwide, D, E and F. Thus, this MLST scheme and the identified SNPs can be used for global epidemiologic, evolutionary and genetic population studies.
The development of the scheme was funded by Public Health Service Grants from the Naitonal Institutes of Health, USA, R01 AI059647, R01AI039499 and R01 EY/AI012219 (to D. Dean), a European Union grant EU-FP6-LSHG-CT-2007-037637 (to S. A. Morré) and a grant from the Wellcome Trust (to B. Spratt).
Dean D, Bruno WJ, Wan R, Gomes JP, Devignot S, Mehari T, Servaas A. Morre, Myers G, Read TD, and Spratt BG. Predicting Phenotype and Emerging Strains among Chlamydia trachomatis Infections. Emerging Infectious Diseases 2009;15:1385-94., published online August 28, 2009.
Housekeeping genes and PCR primers
Locus |
Genome Region |
Primer name |
Primer Sequence (5'-3') |
Product Length |
glyA |
CT432 |
FglyA
RglyA |
GAAGACTGTGGCGCTGTTTTATGG
CTTCCTGAGCGATCCCTTCTGAC |
522 |
mdhC |
CT376 |
FmdhC
RmdhC |
GGAGATGTTTTTGGCCTTGATTGT
CGATTACTGCACTACCACGACTCT |
519 |
pdhA |
CT245 |
FpdhA
RpdhA |
CTACAGAAGCCCGAGTTTTT
CTGTTTGTTGCATGTGGTGATAAG |
549 |
yhbG |
CT653 |
FyhbG
RyhbG |
TCAAGTCAATGCAGGAGAAAT
GATAGTGTTGACGTACCATAGGAT |
504 |
pykF |
CT332 |
FpykF
RpykF |
ACTTAAAATTTGGGGTAGAAC
ACAGCTAAACGATAGTACACAT |
525 |
lysS |
CT781 |
FlysS
RlysS |
GAAGGAATCGATAGAACGCATAAT
ATACGCCGCATAACAGGGAAAAAC |
576 |
leuS |
CT209 |
FleuS
RleuS |
TCCCTTGGTCGATCTCCTCAC
ACTATTTACGTTTTTGCGATGCCC |
519 |
PCR Conditions for MLST housekeeping genes
DNA was extracted from isolates or clinical cervical or conjunctival swabs using the respective Roche High Pure Kits (Roche Diagnostics, Pleasanton, CA, USA). MLST PCR was carried out in 96-well plates as described by Meats et al. (Meats E, Feil EJ, Stringer S, Cody AJ, Goldstein R, Kroll JS, et al. Characterization of encapsulated and noncapsulated Haemophilus influenzae and determination of phylogenetic relationships by multilocus sequence typing. J Clin Microbiol. 2003;41:1623-36). Alternatively, we have used AccuPower Hot Start premix PCR tubes (BioNEER, Alameda, CA) at a total volume of 20ul with 50ng of purified DNA. For PCR, the denaturation was set at 95oC for 4 min, followed by 30 cycles of 95oC for 30 s, 55oC for 30 s, and 72oC for 60 s, and a final extention step of 10 min at 72oC. Each PCR product was run on a 1.5% agarose gel, the correct size band was excised from the gel and the DNA was purified using GENECLEAN (BIO 101, La Jolla, CA).
|
 |